Transcript: Human NR_033857.1

Homo sapiens BMS1 pseudogene 21 (BMS1P21), non-coding RNA.

Source:
NCBI, updated 2019-01-21
Taxon:
Homo sapiens (human)
Gene:
BMS1P21 (100288974)
Length:
818
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033857.1
NBCI Gene record:
BMS1P21 (100288974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10370 pDONR223 100% 33.8% None (many diffs) n/a
2 ccsbBroad304_10370 pLX_304 0% 33.8% V5 (many diffs) n/a
3 TRCN0000467881 ATCACAGGCGGCGTAGCCGACCCG pLX_317 71.9% 33.8% V5 (many diffs) n/a
Download CSV