Transcript: Human NR_034059.1

Homo sapiens proteasome 26S subunit, non-ATPase 1 (PSMD1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PSMD1 (5707)
Length:
3159
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_034059.1
NBCI Gene record:
PSMD1 (5707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_034059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058105 GCACGTCAAGATGTTTATGAT pLKO.1 1457 3UTR 100% 5.625 7.875 N PSMD1 n/a
2 TRCN0000290085 GCACGTCAAGATGTTTATGAT pLKO_005 1457 3UTR 100% 5.625 7.875 N PSMD1 n/a
3 TRCN0000058104 CCCAGAACCATTTGAGTATAT pLKO.1 2824 3UTR 100% 13.200 9.240 N PSMD1 n/a
4 TRCN0000290016 CCCAGAACCATTTGAGTATAT pLKO_005 2824 3UTR 100% 13.200 9.240 N PSMD1 n/a
5 TRCN0000058106 GCTGTAAGTGATGTTAATGAT pLKO.1 1808 3UTR 100% 5.625 3.938 N PSMD1 n/a
6 TRCN0000290014 GCTGTAAGTGATGTTAATGAT pLKO_005 1808 3UTR 100% 5.625 3.938 N PSMD1 n/a
7 TRCN0000058107 GCATCATCATTCTGAAGGATA pLKO.1 2721 3UTR 100% 4.950 3.465 N PSMD1 n/a
8 TRCN0000290082 GCATCATCATTCTGAAGGATA pLKO_005 2721 3UTR 100% 4.950 3.465 N PSMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_034059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.