Transcript: Human NR_034162.1

Homo sapiens long intergenic non-protein coding RNA 1940 (LINC01940), long non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LINC01940 (401039)
Length:
3489
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_034162.1
NBCI Gene record:
LINC01940 (401039)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_034162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164862 GCTTGGAGTGCAGCAAATGTT pLKO.1 332 3UTR 100% 5.625 3.938 N LINC01940 n/a
2 TRCN0000166412 CAACCGAAGGAGAGACAACAT pLKO.1 255 3UTR 100% 4.950 3.465 N LINC01940 n/a
3 TRCN0000165311 CCCAGATGGAAGCAAAGACAA pLKO.1 567 3UTR 100% 4.950 3.465 N LINC01940 n/a
4 TRCN0000164658 CCGAAGGAGAGACAACATTCA pLKO.1 258 3UTR 100% 4.950 3.465 N LINC01940 n/a
5 TRCN0000166276 CTGTAAGCCCTGGAATGCAAA pLKO.1 475 3UTR 100% 4.950 3.465 N LINC01940 n/a
6 TRCN0000166075 GCTCTGTACAGAGTTCTCCAT pLKO.1 646 3UTR 100% 2.640 1.848 N LINC01940 n/a
7 TRCN0000165203 GTTCTCCATCTACTTCTCCCA pLKO.1 658 3UTR 100% 0.660 0.462 N LINC01940 n/a
8 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2160 3UTR 100% 1.080 0.540 Y GPR83 n/a
9 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2160 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_034162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.