Transcript: Human NR_036682.2

Homo sapiens BAF chromatin remodeling complex subunit BCL7B (BCL7B), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
BCL7B (9275)
Length:
1655
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036682.2
NBCI Gene record:
BCL7B (9275)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033574 CACGTCCCTGAGGATATTTAA pLKO.1 224 3UTR 100% 15.000 21.000 N BCL7B n/a
2 TRCN0000299868 CACGTCCCTGAGGATATTTAA pLKO_005 224 3UTR 100% 15.000 21.000 N BCL7B n/a
3 TRCN0000303828 TCCTGGCCCTGCCTCTATTTA pLKO_005 734 3UTR 100% 15.000 10.500 N BCL7B n/a
4 TRCN0000033575 CCTAATGGCTTTCCTTCTGAT pLKO.1 312 3UTR 100% 4.950 3.465 N BCL7B n/a
5 TRCN0000299792 CCTAATGGCTTTCCTTCTGAT pLKO_005 312 3UTR 100% 4.950 3.465 N BCL7B n/a
6 TRCN0000033577 CCTACCCTCACCAAGGAAGAA pLKO.1 579 3UTR 100% 4.950 3.465 N BCL7B n/a
7 TRCN0000299865 CCTACCCTCACCAAGGAAGAA pLKO_005 579 3UTR 100% 4.950 3.465 N BCL7B n/a
8 TRCN0000193052 CCCTGCCTCTATTTATTGCAT pLKO.1 740 3UTR 100% 3.000 2.100 N Bcl7b n/a
9 TRCN0000033576 CCCAGCACACACCTCCGACTT pLKO.1 470 3UTR 100% 0.000 0.000 N BCL7B n/a
10 TRCN0000299791 CCCAGCACACACCTCCGACTT pLKO_005 470 3UTR 100% 0.000 0.000 N BCL7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.