Transcript: Human NR_037873.1

Homo sapiens zinc fingers and homeoboxes 1 (ZHX1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
ZHX1 (11244)
Length:
5070
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037873.1
NBCI Gene record:
ZHX1 (11244)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244964 GACTATGGTGAAACGTAATAA pLKO_005 940 3UTR 100% 15.000 21.000 N ZHX1 n/a
2 TRCN0000244965 TCGGGAATATCTATCAGTAAA pLKO_005 1061 3UTR 100% 13.200 18.480 N ZHX1 n/a
3 TRCN0000020358 CGCCAATTCAAGTAGTATGAA pLKO.1 2725 3UTR 100% 5.625 7.875 N ZHX1 n/a
4 TRCN0000244968 TCTAGTAAGATGGGCTATATA pLKO_005 3529 3UTR 100% 15.000 12.000 N ZHX1 n/a
5 TRCN0000244966 AGTAATGGTTTACCATCTATT pLKO_005 1673 3UTR 100% 13.200 10.560 N ZHX1 n/a
6 TRCN0000020355 GCCTGACGAAAGGAGAGATTA pLKO.1 2046 3UTR 100% 13.200 10.560 N ZHX1 n/a
7 TRCN0000244967 CTGCAATACTTAAGGATTATT pLKO_005 2886 3UTR 100% 15.000 10.500 N ZHX1 n/a
8 TRCN0000020357 CCTCAGACCATAACTGTTATT pLKO.1 1631 3UTR 100% 13.200 9.240 N ZHX1 n/a
9 TRCN0000020356 GCAGTTCATCATAACTCAGTT pLKO.1 1130 3UTR 100% 4.950 3.465 N ZHX1 n/a
10 TRCN0000020354 CCAGTGATGAAACCACGGAAT pLKO.1 2166 3UTR 100% 4.050 2.835 N ZHX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.