Transcript: Human NR_037942.2

Homo sapiens syntaxin 16 (STX16), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
STX16 (8675)
Length:
4116
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037942.2
NBCI Gene record:
STX16 (8675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219995 CTAATTGAGAGAGCGTTATTT pLKO.1 3830 3UTR 100% 15.000 21.000 N STX16 n/a
2 TRCN0000219994 CATCGTTTACCTACCTATTAT pLKO.1 2064 3UTR 100% 15.000 10.500 N STX16 n/a
3 TRCN0000229992 CATCGTTTACCTACCTATTAT pLKO_005 2064 3UTR 100% 15.000 10.500 N STX16 n/a
4 TRCN0000218212 ATCGGAAGATGCTTGTGATTT pLKO_005 799 3UTR 100% 13.200 9.240 N STX16 n/a
5 TRCN0000161981 GAATCGGAAGATGCTTGTGAT pLKO.1 797 3UTR 100% 4.950 3.465 N STX16 n/a
6 TRCN0000218497 AGGAACATGCCATTGAGATAA pLKO_005 419 3UTR 100% 13.200 6.600 Y STX16 n/a
7 TRCN0000229991 GTATGATGTTGGCCGGATTAA pLKO_005 324 3UTR 100% 13.200 6.600 Y STX16 n/a
8 TRCN0000166416 CGAGAGATTCGCCAGATTGTA pLKO.1 615 3UTR 100% 5.625 2.813 Y STX16 n/a
9 TRCN0000162176 CGTTGAACAGTCCTGTATCAA pLKO.1 725 3UTR 100% 5.625 2.813 Y STX16 n/a
10 TRCN0000159935 GTGGATGAAATTCAGTATGAT pLKO.1 310 3UTR 100% 5.625 2.813 Y STX16 n/a
11 TRCN0000162031 CGATGATTGTAGAACAGGGTA pLKO.1 679 3UTR 100% 2.640 1.320 Y STX16 n/a
12 TRCN0000161930 GCCATTGAGATAACTACCCAA pLKO.1 427 3UTR 100% 2.640 1.320 Y STX16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.