Transcript: Human NR_038135.2

Homo sapiens MGAT4 family member E, pseudogene (MGAT4EP), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
MGAT4EP (641515)
Length:
2819
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_038135.2
NBCI Gene record:
MGAT4EP (641515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_038135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_038135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10656 pDONR223 100% 21.7% None 1_1100del;1253T>C;1716_2819del n/a
2 ccsbBroad304_10656 pLX_304 0% 21.7% V5 1_1100del;1253T>C;1716_2819del n/a
3 TRCN0000476392 CATTCTCCCAGAGTAAGGCATTTT pLX_317 36.9% 21.7% V5 1_1100del;1253T>C;1716_2819del n/a
Download CSV