Transcript: Human NR_045756.3

Homo sapiens collagen type XXV alpha 1 chain (COL25A1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
COL25A1 (84570)
Length:
4921
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045756.3
NBCI Gene record:
COL25A1 (84570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116385 CACGAAGCCTTACAGAGGATT pLKO.1 1502 3UTR 100% 4.950 6.930 N COL25A1 n/a
2 TRCN0000116384 GCTCAGAAATCCTATGAACAT pLKO.1 704 3UTR 100% 4.950 6.930 N COL25A1 n/a
3 TRCN0000116386 CCTCAAGACTATGGTGCAAGA pLKO.1 664 3UTR 100% 4.050 3.240 N COL25A1 n/a
4 TRCN0000417328 CACAGGGTCCTTCTATCATAG pLKO_005 1717 3UTR 100% 10.800 7.560 N COL25A1 n/a
5 TRCN0000427935 AGGAGCCACTGAGATCATAGA pLKO_005 1465 3UTR 100% 4.950 3.465 N COL25A1 n/a
6 TRCN0000116383 GCTGCAGGAATTAAGGGAGAA pLKO.1 1121 3UTR 100% 4.050 2.835 N COL25A1 n/a
7 TRCN0000089716 GCAGGAATTAAGGGAGAACCT pLKO.1 1124 3UTR 100% 2.640 1.848 N Col25a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.