Transcript: Human NR_045796.1

Homo sapiens chromosome segregation 1 like (CSE1L), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
CSE1L (1434)
Length:
3142
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045796.1
NBCI Gene record:
CSE1L (1434)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061788 CCTGGGTTACTAGGTGTCTTT pLKO.1 1886 3UTR 100% 4.950 6.930 N CSE1L n/a
2 TRCN0000061790 CGCTGACAAGTATCTGTGAAA pLKO.1 720 3UTR 100% 4.950 6.930 N CSE1L n/a
3 TRCN0000315697 CGCTGACAAGTATCTGTGAAA pLKO_005 720 3UTR 100% 4.950 6.930 N CSE1L n/a
4 TRCN0000061789 GCATGGAATTACACAAGCAAA pLKO.1 1039 3UTR 100% 4.950 3.960 N CSE1L n/a
5 TRCN0000315632 GCATGGAATTACACAAGCAAA pLKO_005 1039 3UTR 100% 4.950 3.960 N CSE1L n/a
6 TRCN0000061792 CCGTCTTCCTATATGGCCTTA pLKO.1 1739 3UTR 100% 4.050 2.835 N CSE1L n/a
7 TRCN0000315698 CCGTCTTCCTATATGGCCTTA pLKO_005 1739 3UTR 100% 4.050 2.835 N CSE1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.