Transcript: Mouse NR_046214.1

Mus musculus predicted gene 2381 (Gm2381), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gm2381 (100039706)
Length:
4075
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046214.1
NBCI Gene record:
Gm2381 (100039706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_046214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 484 3UTR 100% 13.200 6.600 Y Zfp934 n/a
2 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 484 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
3 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 484 3UTR 100% 13.200 6.600 Y EG668616 n/a
4 TRCN0000234198 TCACCGCTATAGGCTACAATT pLKO_005 226 3UTR 100% 13.200 6.600 Y Zfp936 n/a
5 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 317 3UTR 100% 13.200 6.600 Y Zfp977 n/a
6 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 3029 3UTR 100% 5.625 2.813 Y ZNF345 n/a
7 TRCN0000096056 GCCTTCAAATATCACAGTCAT pLKO.1 354 3UTR 100% 4.950 2.475 Y Zfp975 n/a
8 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 903 3UTR 100% 15.000 7.500 Y Gm10771 n/a
9 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 903 3UTR 100% 15.000 7.500 Y ZNF286B n/a
10 TRCN0000152004 CTGGTGAGAAACCTTATGAAT pLKO.1 3197 3UTR 100% 5.625 2.813 Y ZNF829 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.