Transcript: Human NR_046453.2

Homo sapiens chloride voltage-gated channel 1 (CLCN1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CLCN1 (1180)
Length:
3040
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046453.2
NBCI Gene record:
CLCN1 (1180)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432282 GATGAGGATCACTATTCTAAA pLKO_005 376 3UTR 100% 13.200 18.480 N CLCN1 n/a
2 TRCN0000043886 GCTGTGATTTGCTTCGAATTA pLKO.1 1582 3UTR 100% 13.200 18.480 N CLCN1 n/a
3 TRCN0000043887 CCCACACAGATTTATGGCCAT pLKO.1 274 3UTR 100% 2.160 3.024 N CLCN1 n/a
4 TRCN0000445322 CCACCAGGAATGGGTCAATTC pLKO_005 1324 3UTR 100% 10.800 8.640 N CLCN1 n/a
5 TRCN0000416765 ACCAATTTCCGAATGGATTTC pLKO_005 1108 3UTR 100% 10.800 7.560 N CLCN1 n/a
6 TRCN0000043883 CCCGAAATGAAGACAATACTT pLKO.1 676 3UTR 100% 5.625 3.938 N CLCN1 n/a
7 TRCN0000043885 CGACTTCAACTCGAAAGAGTA pLKO.1 2624 3UTR 100% 4.950 3.465 N CLCN1 n/a
8 TRCN0000043884 GCTCAGCAAATATACCATCTT pLKO.1 1746 3UTR 100% 4.950 3.465 N CLCN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.