Transcript: Human NR_047676.1

Homo sapiens threonyl-tRNA synthetase 1 (TARS1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-08-24
Taxon:
Homo sapiens (human)
Gene:
TARS1 (6897)
Length:
2996
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_047676.1
NBCI Gene record:
TARS1 (6897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_047676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344636 CAACCTGCAGGCGTAACTATT pLKO_005 2729 3UTR 100% 13.200 18.480 N TARS1 n/a
2 TRCN0000344689 CGTACGGTATATAGCGTATTT pLKO_005 1882 3UTR 100% 13.200 18.480 N TARS1 n/a
3 TRCN0000344635 TGGCCGACAACACCGTTATTG pLKO_005 770 3UTR 100% 13.200 18.480 N TARS1 n/a
4 TRCN0000045678 GCACTGTTAATATCCGCACAA pLKO.1 2483 3UTR 100% 4.050 5.670 N TARS1 n/a
5 TRCN0000333071 GCACTGTTAATATCCGCACAA pLKO_005 2483 3UTR 100% 4.050 5.670 N TARS1 n/a
6 TRCN0000045680 GCACTCTAGTGCTCACATAAT pLKO.1 894 3UTR 100% 13.200 9.240 N TARS1 n/a
7 TRCN0000333070 GCACTCTAGTGCTCACATAAT pLKO_005 894 3UTR 100% 13.200 9.240 N TARS1 n/a
8 TRCN0000045681 CCTGTGATGAATATGCCCAAA pLKO.1 2318 3UTR 100% 4.050 2.835 N TARS1 n/a
9 TRCN0000045682 CTCCAGAGAATTTATGGCATT pLKO.1 1312 3UTR 100% 4.050 2.835 N TARS1 n/a
10 TRCN0000045679 GCCTACATTTATAATGCACTT pLKO.1 1480 3UTR 100% 4.050 2.835 N TARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_047676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15604 pDONR223 0% 71.1% None (many diffs) n/a
2 ccsbBroad304_15604 pLX_304 0% 71.1% V5 (many diffs) n/a
Download CSV