Transcript: Human NR_073428.1

Homo sapiens CWC25 spliceosome associated protein homolog (CWC25), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-04-20
Taxon:
Homo sapiens (human)
Gene:
CWC25 (54883)
Length:
3229
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073428.1
NBCI Gene record:
CWC25 (54883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143242 GATCACAGAAGAAGATGGCAA pLKO.1 910 3UTR 100% 2.640 3.696 N CWC25 n/a
2 TRCN0000447386 TCGAGTAGTGATCGTTCCAGC pLKO_005 864 3UTR 100% 2.160 3.024 N CWC25 n/a
3 TRCN0000141403 CATCCTCAAGAGGCATGCTAA pLKO.1 1367 3UTR 100% 4.950 3.960 N CWC25 n/a
4 TRCN0000437227 GGCATGCTAAGGATGAGGAAC pLKO_005 1378 3UTR 100% 4.050 3.240 N CWC25 n/a
5 TRCN0000142481 GCTCACTTCCTTTGAGAGCTA pLKO.1 1711 3UTR 100% 2.640 2.112 N CWC25 n/a
6 TRCN0000144907 GAAGCGGAATATCTACTCTTT pLKO.1 1496 3UTR 100% 4.950 3.465 N CWC25 n/a
7 TRCN0000445109 GATGGTGAACCGTGACGAGTA pLKO_005 521 3UTR 100% 4.050 2.835 N CWC25 n/a
8 TRCN0000140986 CGGAAGAAGATTGAGGAGCTT pLKO.1 267 3UTR 100% 2.640 1.848 N CWC25 n/a
9 TRCN0000143371 GAATGTGGAGAAAGTGTGGAA pLKO.1 221 3UTR 100% 2.640 1.848 N CWC25 n/a
10 TRCN0000142427 GAAGTTCATCCACCGCATGAA pLKO.1 1436 3UTR 100% 0.495 0.347 N CWC25 n/a
11 TRCN0000418759 AGAACCATTCCAGATCCAGAA pLKO_005 1048 3UTR 100% 4.050 2.430 N CWC25 n/a
12 TRCN0000140964 CCTGCTTCATTGAGTCCTGAA pLKO.1 1687 3UTR 100% 4.050 2.430 N CWC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.