Transcript: Human NR_073445.1

Homo sapiens integrator complex subunit 8 (INTS8), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
INTS8 (55656)
Length:
3500
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073445.1
NBCI Gene record:
INTS8 (55656)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139073 CACAATGTTCGGGAGGACATT pLKO.1 2452 3UTR 100% 0.495 0.693 N INTS8 n/a
2 TRCN0000121938 CCTCAGAGAAATTGACTACAA pLKO.1 2942 3UTR 100% 4.950 3.465 N INTS8 n/a
3 TRCN0000144908 GAAGAACGAAAGCTACTTGTT pLKO.1 1525 3UTR 100% 4.950 3.465 N INTS8 n/a
4 TRCN0000145179 GATGAAGAACGAAAGCTACTT pLKO.1 1522 3UTR 100% 4.950 3.465 N INTS8 n/a
5 TRCN0000143341 GCAGCTACATGCAAAGAACTT pLKO.1 2203 3UTR 100% 4.950 3.465 N INTS8 n/a
6 TRCN0000143028 CTTTGCTGCTTGTTTGGAGTT pLKO.1 1887 3UTR 100% 4.050 2.835 N INTS8 n/a
7 TRCN0000143876 CCCTGATGTTTATACAGACCA pLKO.1 2849 3UTR 100% 2.640 1.848 N INTS8 n/a
8 TRCN0000122173 GATGTTTATACAGACCAGGTA pLKO.1 2853 3UTR 100% 2.640 1.848 N INTS8 n/a
9 TRCN0000143466 GCAATCACAGTGAAAGAGCTA pLKO.1 2676 3UTR 100% 2.640 1.848 N INTS8 n/a
10 TRCN0000122063 CCCTAGAGTAAATCTGTGCAT pLKO.1 1566 3UTR 100% 2.640 1.584 N INTS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.