Transcript: Human NR_073510.2

Homo sapiens one cut homeobox 1 (ONECUT1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-12-06
Taxon:
Homo sapiens (human)
Gene:
ONECUT1 (3175)
Length:
3098
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073510.2
NBCI Gene record:
ONECUT1 (3175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014966 CGTCGAACTCTACATGCAATA pLKO.1 373 3UTR 100% 10.800 15.120 N ONECUT1 n/a
2 TRCN0000014963 CCTCAAGATAGCAGGTTTATA pLKO.1 652 3UTR 100% 15.000 12.000 N ONECUT1 n/a
3 TRCN0000424313 AGCGTTATTTATAGTCCAAAG pLKO_005 697 3UTR 100% 6.000 4.800 N ONECUT1 n/a
4 TRCN0000429942 CCATCCAAAGAATTGCAAATC pLKO_005 412 3UTR 100% 10.800 7.560 N ONECUT1 n/a
5 TRCN0000014964 GCTCCAATTCAGGCAACTCAT pLKO.1 530 3UTR 100% 4.950 3.465 N ONECUT1 n/a
6 TRCN0000418807 CTCACCTGCATTCTGACTTTG pLKO_005 733 3UTR 100% 10.800 6.480 N ONECUT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.