Transcript: Human NR_073597.2

Homo sapiens ATPase phospholipid transporting 8B4 (putative) (ATP8B4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ATP8B4 (79895)
Length:
5540
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073597.2
NBCI Gene record:
ATP8B4 (79895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051913 CGCCACTAAGTATTCTAAATA pLKO.1 4315 3UTR 100% 15.000 21.000 N ATP8B4 n/a
2 TRCN0000051916 GCCATGCACTATCAGTTACTT pLKO.1 680 3UTR 100% 5.625 7.875 N ATP8B4 n/a
3 TRCN0000418566 GTTTATCACTAGCCAATATTA pLKO_005 2138 3UTR 100% 15.000 10.500 N ATP8B4 n/a
4 TRCN0000438443 ATGGATCCTCAGGCGGATAAA pLKO_005 3924 3UTR 100% 13.200 9.240 N ATP8B4 n/a
5 TRCN0000051914 GCAGATACTATTCTGTTTGAA pLKO.1 1837 3UTR 100% 5.625 3.938 N ATP8B4 n/a
6 TRCN0000051915 GCAGGGAATAATGCTGTGGAA pLKO.1 2257 3UTR 100% 2.640 1.848 N ATP8B4 n/a
7 TRCN0000051917 CCAGTTTCCATTTGTTGGTAA pLKO.1 3155 3UTR 100% 4.950 2.970 N ATP8B4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.