Transcript: Mouse NR_102727.1

Mus musculus lactate dehydrogenase A (Ldha), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ldha (16828)
Length:
1543
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102727.1
NBCI Gene record:
Ldha (16828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_102727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041743 GTTCCCAGTTAAGTCGTATAA pLKO.1 1307 3UTR 100% 13.200 9.240 N Ldha n/a
2 TRCN0000308704 GTTCCCAGTTAAGTCGTATAA pLKO_005 1307 3UTR 100% 13.200 9.240 N Ldha n/a
3 TRCN0000041745 CGTCTCCAATCCAGTGGATAT pLKO.1 543 3UTR 100% 10.800 6.480 N Ldha n/a
4 TRCN0000041744 CGTGAACATCTTCAAGTTCAT pLKO.1 477 3UTR 100% 0.495 0.297 N Ldha n/a
5 TRCN0000308638 CGTGAACATCTTCAAGTTCAT pLKO_005 477 3UTR 100% 0.495 0.297 N Ldha n/a
6 TRCN0000041247 GCTTGTGCCATCAGTATCTTA pLKO.1 238 3UTR 100% 5.625 2.813 Y LOC242317 n/a
7 TRCN0000041746 CCAGCAAAGACTACTGTGTAA pLKO.1 374 3UTR 100% 4.950 2.475 Y Ldha n/a
8 TRCN0000308635 CCAGCAAAGACTACTGTGTAA pLKO_005 374 3UTR 100% 4.950 2.475 Y Ldha n/a
9 TRCN0000041245 GCATCCCATTTCCACCATGAT pLKO.1 830 3UTR 100% 4.950 2.475 Y LOC242317 n/a
10 TRCN0000158496 CAGTATCTTAATGAAGGACTT pLKO.1 249 3UTR 100% 4.050 2.025 Y LDHA n/a
11 TRCN0000026538 CCACCATGATTAAGGGTCTTT pLKO.1 841 3UTR 100% 4.950 2.475 Y LDHA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06518 pDONR223 100% 45.9% None (many diffs) n/a
2 ccsbBroad304_06518 pLX_304 0% 45.9% V5 (many diffs) n/a
Download CSV