Transcript: Human NR_103530.2

Homo sapiens ankyrin repeat and LEM domain containing 1 (ANKLE1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
ANKLE1 (126549)
Length:
2706
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103530.2
NBCI Gene record:
ANKLE1 (126549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165587 GACTTTCATCCGTGCCATCTT pLKO.1 1198 3UTR 100% 4.950 6.930 N ANKLE1 n/a
2 TRCN0000161295 GCACAAGATAACGGGTCATAA pLKO.1 2049 3UTR 100% 13.200 9.240 N ANKLE1 n/a
3 TRCN0000166744 CCCTTGAAACTGTGGACAAAC pLKO.1 607 3UTR 100% 10.800 7.560 N ANKLE1 n/a
4 TRCN0000165874 GAGCACCAGACATCCATTGAT pLKO.1 984 3UTR 100% 5.625 3.938 N ANKLE1 n/a
5 TRCN0000158977 GACATCCATTGATAGTGACAT pLKO.1 992 3UTR 100% 4.950 3.465 N ANKLE1 n/a
6 TRCN0000165375 GTCTGACTTGGAGTTGCTGAA pLKO.1 1103 3UTR 100% 4.050 2.835 N ANKLE1 n/a
7 TRCN0000160617 CCAGATGGTTAAAGCATTCTA pLKO.1 2003 3UTR 100% 5.625 3.375 N ANKLE1 n/a
8 TRCN0000159231 CGAAACCCTATCTCTACTAAA pLKO.1 2311 3UTR 100% 13.200 6.600 Y ANKLE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.