Transcript: Human NR_104224.2

Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SH3YL1 (26751)
Length:
3165
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104224.2
NBCI Gene record:
SH3YL1 (26751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15788 pDONR223 0% 10.7% None 1_198del;209C>A;541_3165del n/a
2 ccsbBroad304_15788 pLX_304 0% 10.7% V5 1_198del;209C>A;541_3165del n/a
3 TRCN0000468192 CACGTACTCACAGTCCTTGGCTAC pLX_317 90.3% 10.7% V5 1_198del;209C>A;541_3165del n/a
Download CSV