Transcript: Human NR_104231.2

Homo sapiens solute carrier family 66 member 3 (SLC66A3), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SLC66A3 (130814)
Length:
1791
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104231.2
NBCI Gene record:
SLC66A3 (130814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245603 CTACCGGAAGACCGCTATAAA pLKO_005 733 3UTR 100% 15.000 21.000 N SLC66A3 n/a
2 TRCN0000245606 CACTCCTTACATCGCTGTATT pLKO_005 359 3UTR 100% 13.200 18.480 N SLC66A3 n/a
3 TRCN0000245605 TCCTCACTTCGTTAGGTTATG pLKO_005 954 3UTR 100% 10.800 15.120 N SLC66A3 n/a
4 TRCN0000245604 CTGAATGATGGATACATTATT pLKO_005 756 3UTR 100% 15.000 10.500 N SLC66A3 n/a
5 TRCN0000245602 CCCTGCAGAAGTGGATCATAG pLKO_005 403 3UTR 100% 10.800 7.560 N SLC66A3 n/a
6 TRCN0000183349 GCTTTCTGATTCAAGTACAAT pLKO.1 1446 3UTR 100% 5.625 3.938 N SLC66A3 n/a
7 TRCN0000180057 CCACTCCTTACATCGCTGTAT pLKO.1 358 3UTR 100% 4.950 3.465 N SLC66A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09529 pDONR223 100% 33.7% None (many diffs) n/a
Download CSV