Transcript: Mouse NR_104384.1

Mus musculus vomeronasal 2, receptor 89 (Vmn2r89), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2014-05-14
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r89 (22301)
Length:
2457
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104384.1
NBCI Gene record:
Vmn2r89 (22301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104384.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042742 AGGTAGAACACAACAGATATT pLKO.1 1053 3UTR 100% 13.200 7.920 N Vmn2r89 n/a
2 TRCN0000042744 GCTTCAGAAGATGGGAAGATT pLKO.1 639 3UTR 100% 5.625 3.375 N Vmn2r89 n/a
3 TRCN0000257361 CAGACCACATTTGGAGTATTT pLKO_005 1402 3UTR 100% 13.200 6.600 Y Gm20783 n/a
4 TRCN0000042738 CCTCCATTTATTGACAGAGAT pLKO.1 1600 3UTR 100% 4.950 2.475 Y Vmn2r89 n/a
5 TRCN0000188381 CTAGGAACCTTCCTGACACAT pLKO.1 1742 3UTR 100% 4.950 2.475 Y LOC436147 n/a
6 TRCN0000104882 CTTTGGACCATTTAATCCTAA pLKO.1 292 3UTR 100% 4.950 2.475 Y Vmn2r-ps159 n/a
7 TRCN0000042741 GCACACCACAAAGTTGAGATT pLKO.1 758 3UTR 100% 4.950 2.475 Y Vmn2r89 n/a
8 TRCN0000042748 GCATGGGATCTGTTTAGCTTT pLKO.1 490 3UTR 100% 4.950 2.475 Y Vmn2r-ps159 n/a
9 TRCN0000042745 GCTGTTTGACTGAAGCAAGTT pLKO.1 142 3UTR 100% 4.950 2.475 Y Vmn2r89 n/a
10 TRCN0000027858 GCAAACAATGAACACTGCCAA pLKO.1 799 3UTR 100% 2.640 1.320 Y Vmn2r123 n/a
11 TRCN0000104880 GCTGTATCATTTCTGGCTTAT pLKO.1 1165 3UTR 100% 10.800 5.400 Y Vmn2r-ps159 n/a
12 TRCN0000104883 TGGAGGATAAAGAATAGTGAT pLKO.1 168 3UTR 100% 4.950 2.475 Y Vmn2r-ps159 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104384.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.