Transcript: Human NR_109973.1

Homo sapiens deleted in lymphocytic leukemia 1 (DLEU1), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DLEU1 (10301)
Length:
2957
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_109973.1
NBCI Gene record:
DLEU1 (10301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_109973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072493 CCAGCATGTTTCTCCCATTTA pLKO.1 786 3UTR 100% 13.200 9.240 N DLEU1 n/a
2 TRCN0000072494 TGAGTCACAATGCAGACAAAT pLKO.1 485 3UTR 100% 13.200 9.240 N DLEU1 n/a
3 TRCN0000072497 GACAAATATCAAATGGGAGAT pLKO.1 499 3UTR 100% 4.050 2.835 N DLEU1 n/a
4 TRCN0000072496 AGATTGTTGCAAGGAAGAGAT pLKO.1 516 3UTR 100% 4.950 2.970 N DLEU1 n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1125 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000072495 CCTCGGAACAACTTTACCAGT pLKO.1 370 3UTR 100% 2.640 2.112 N DLEU1 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1126 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_109973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.