Transcript: Mouse NR_110348.1

Mus musculus synaptotagmin-like 2 (Sytl2), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sytl2 (83671)
Length:
2355
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110348.1
NBCI Gene record:
Sytl2 (83671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_110348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381173 AGATCACTCCTTGCAACAAAC pLKO_005 1261 3UTR 100% 10.800 15.120 N Sytl2 n/a
2 TRCN0000093350 GCTAGGAAATTGCCTTCCAAA pLKO.1 2264 3UTR 100% 4.950 6.930 N Sytl2 n/a
3 TRCN0000382093 CTCAGAGACCCTCCGTTTAAA pLKO_005 1606 3UTR 100% 15.000 10.500 N Sytl2 n/a
4 TRCN0000381381 AGCTCACTAGAGCCGTTAAAG pLKO_005 1727 3UTR 100% 13.200 9.240 N Sytl2 n/a
5 TRCN0000379936 AGCTTCCAGTGTGATTGATAT pLKO_005 1159 3UTR 100% 13.200 9.240 N Sytl2 n/a
6 TRCN0000380365 GGAGCAAGACGCCATCTTAAA pLKO_005 784 3UTR 100% 13.200 9.240 N Sytl2 n/a
7 TRCN0000380108 GGCTCCAAGAGGGATCCTAAA pLKO_005 1558 3UTR 100% 10.800 7.560 N Sytl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.