Transcript: Human NR_111909.1

Homo sapiens leucine rich repeat transmembrane neuronal 3 (LRRTM3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-08-11
Taxon:
Homo sapiens (human)
Gene:
LRRTM3 (347731)
Length:
4095
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111909.1
NBCI Gene record:
LRRTM3 (347731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432876 GCCGAATCAGTGACCATAAAC pLKO_005 306 3UTR 100% 13.200 18.480 N LRRTM3 n/a
2 TRCN0000131077 GCCCAGAAACCTTGACTCTAA pLKO.1 831 3UTR 100% 4.950 3.465 N LRRTM3 n/a
3 TRCN0000128916 GCCTAGTTTCTAAGCAGTGAA pLKO.1 1068 3UTR 100% 4.950 3.465 N LRRTM3 n/a
4 TRCN0000130410 GCCTTGAATTACAGCCTAGTT pLKO.1 1055 3UTR 100% 4.950 3.465 N LRRTM3 n/a
5 TRCN0000194335 CTCTCCCATAAGTCCTTTGAA pLKO.1 212 3UTR 100% 5.625 3.375 N Lrrtm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.