Transcript: Human NR_122035.1

Homo sapiens ARRDC1 antisense RNA 1 (ARRDC1-AS1), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ARRDC1-AS1 (85026)
Length:
1507
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_122035.1
NBCI Gene record:
ARRDC1-AS1 (85026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_122035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167341 CAAGGCACAAATTTAACCAAA pLKO.1 1168 3UTR 100% 4.950 6.930 N ARRDC1-AS1 n/a
2 TRCN0000263759 CAGGAGCCAAGGCACAAATTT pLKO_005 1161 3UTR 100% 15.000 10.500 N ARRDC1-AS1 n/a
3 TRCN0000263762 CACCACCATCTCCGTTGTTTC pLKO_005 835 3UTR 100% 10.800 7.560 N ARRDC1-AS1 n/a
4 TRCN0000263761 TTGGGAACCTGGGTGCCTAAA pLKO_005 1135 3UTR 100% 10.800 7.560 N ARRDC1-AS1 n/a
5 TRCN0000263763 TTCCACAGAACCCTGCCTTTC pLKO_005 944 3UTR 100% 6.000 4.200 N ARRDC1-AS1 n/a
6 TRCN0000172349 CCATCTCCGTTGTTTCTGGAA pLKO.1 840 3UTR 100% 2.640 1.848 N ARRDC1-AS1 n/a
7 TRCN0000263760 AGATAAGGTAACTGACAAACC pLKO_005 755 3UTR 100% 4.050 2.430 N ARRDC1-AS1 n/a
8 TRCN0000172710 GAACTCCTGACCTCAAGCAAT pLKO.1 657 3UTR 100% 4.950 2.475 Y ARRDC1-AS1 n/a
9 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 691 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_122035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.