Transcript: Human NR_126093.1

Homo sapiens DEAD-box helicase 3 X-linked (DDX3X), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
DDX3X (1654)
Length:
3496
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126093.1
NBCI Gene record:
DDX3X (1654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_126093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314545 GAATCAGACAAACGGTCATTT pLKO_005 2215 3UTR 100% 13.200 18.480 N DDX3X n/a
2 TRCN0000000004 CGCTTGGAACAGGAACTCTTT pLKO.1 1378 3UTR 100% 4.950 6.930 N DDX3X n/a
3 TRCN0000000003 CGTAGAATAGTCGAACAAGAT pLKO.1 2029 3UTR 100% 4.950 6.930 N DDX3X n/a
4 TRCN0000314600 CGTAGAATAGTCGAACAAGAT pLKO_005 2029 3UTR 100% 4.950 6.930 N DDX3X n/a
5 TRCN0000000002 CGGAGTGATTACGATGGCATT pLKO.1 1246 3UTR 100% 4.050 5.670 N DDX3X n/a
6 TRCN0000000001 CCCTGCCAAACAAGCTAATAT pLKO.1 2955 3UTR 100% 15.000 10.500 N DDX3X n/a
7 TRCN0000314601 CCCTGCCAAACAAGCTAATAT pLKO_005 2955 3UTR 100% 15.000 10.500 N DDX3X n/a
8 TRCN0000314602 CTAAAGGTTTCTACGATAAAG pLKO_005 1091 3UTR 100% 13.200 9.240 N DDX3X n/a
9 TRCN0000103750 GCTGTGATTCTCCACTGAAAT pLKO.1 3042 3UTR 100% 13.200 9.240 N Ddx3x n/a
10 TRCN0000287305 GCTGTGATTCTCCACTGAAAT pLKO_005 3042 3UTR 100% 13.200 9.240 N Ddx3x n/a
11 TRCN0000000005 AGCAGATTTAGTGGAGGGTTT pLKO.1 2716 3UTR 100% 4.050 2.835 N DDX3X n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.