Transcript: Human NR_130139.1

Homo sapiens NPL4 homolog, ubiquitin recognition factor (NPLOC4), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-04-16
Taxon:
Homo sapiens (human)
Gene:
NPLOC4 (55666)
Length:
3012
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130139.1
NBCI Gene record:
NPLOC4 (55666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153383 GCATTGGCGATTTGTCTGATT pLKO.1 2524 3UTR 100% 4.950 6.930 N NPLOC4 n/a
2 TRCN0000152140 CCTATTTGTCTCAGAATACCT pLKO.1 264 3UTR 100% 3.000 2.400 N NPLOC4 n/a
3 TRCN0000338874 CCACCCAGCCTTCTCTTTATT pLKO_005 970 3UTR 100% 15.000 10.500 N NPLOC4 n/a
4 TRCN0000150649 GCACTATGAACAGAGAACATT pLKO.1 1953 3UTR 100% 5.625 3.938 N NPLOC4 n/a
5 TRCN0000152847 GCGATTTGTCTGATTCTGGTT pLKO.1 2530 3UTR 100% 2.640 1.848 N NPLOC4 n/a
6 TRCN0000153539 CCACATTCTTGGCACTATGAA pLKO.1 1942 3UTR 100% 5.625 3.375 N NPLOC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.