Transcript: Mouse NR_130725.1

Mus musculus DAZ interacting protein 1 (Dzip1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Dzip1 (66573)
Length:
5474
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130725.1
NBCI Gene record:
Dzip1 (66573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_130725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445489 GAATTTGCCAGTAAACCATAC pLKO_005 1524 3UTR 100% 6.000 8.400 N Dzip1 n/a
2 TRCN0000444883 AGCAGAACGAGCTGATTATCA pLKO_005 1483 3UTR 100% 5.625 7.875 N Dzip1 n/a
3 TRCN0000127254 GCCGTTACTAACGAGTTCTTT pLKO.1 4303 3UTR 100% 5.625 7.875 N Dzip1 n/a
4 TRCN0000453219 CCACATAGAGAAGCTTCGAAG pLKO_005 1385 3UTR 100% 4.050 5.670 N Dzip1 n/a
5 TRCN0000127257 GAAGGATTTAAGTGCAGATAA pLKO.1 1415 3UTR 100% 13.200 9.240 N Dzip1 n/a
6 TRCN0000440091 AGCAAGTGGACAGATCGATTT pLKO_005 1317 3UTR 100% 10.800 7.560 N Dzip1 n/a
7 TRCN0000127258 TGGAACCAATAGAAGAACTTT pLKO.1 1705 3UTR 100% 5.625 3.938 N Dzip1 n/a
8 TRCN0000127256 CCGACAAACACTGGAACCTAA pLKO.1 1580 3UTR 100% 4.950 3.465 N Dzip1 n/a
9 TRCN0000127255 CCAGCTATTACCAGTGCCATT pLKO.1 793 3UTR 100% 4.050 2.430 N Dzip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.