Transcript: Human NR_130977.2

Homo sapiens ZFP90 zinc finger protein (ZFP90), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZFP90 (146198)
Length:
4616
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130977.2
NBCI Gene record:
ZFP90 (146198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218382 ACTCTAGGAACCGTGAAATTA pLKO_005 2177 3UTR 100% 15.000 21.000 N ZFP90 n/a
2 TRCN0000181178 CCAACCTGCATGATCATCAGA pLKO.1 2053 3UTR 100% 3.000 4.200 N ZFP90 n/a
3 TRCN0000230392 ACATAATGCAGACTTACTTAA pLKO_005 851 3UTR 100% 13.200 9.240 N ZFP90 n/a
4 TRCN0000230394 ATAGTTTGACAATGGGTAATT pLKO_005 4181 3UTR 100% 13.200 9.240 N ZFP90 n/a
5 TRCN0000218142 CATAGATCATCGCTTACTAAA pLKO_005 936 3UTR 100% 13.200 9.240 N ZFP90 n/a
6 TRCN0000230393 AGTAACTACAGCATAGATTTC pLKO_005 1545 3UTR 100% 10.800 6.480 N ZFP90 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3347 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3347 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000016211 GCGAATTCACACTGGAGAGAA pLKO.1 1259 3UTR 100% 0.000 0.000 Y ZNF2 n/a
10 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1832 3UTR 100% 13.200 6.600 Y Zfp977 n/a
11 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3345 3UTR 100% 4.950 2.475 Y ERN2 n/a
12 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3345 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3345 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.