Transcript: Mouse NR_132314.1

Mus musculus predicted gene, 28043 (Gm28043), long non-coding RNA.

Source:
NCBI, updated 2017-01-24
Taxon:
Mus musculus (mouse)
Gene:
Gm28043 (106014251)
Length:
9228
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132314.1
NBCI Gene record:
Gm28043 (106014251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_132314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264860 AGGCGAGGGATTGGGTAAATA pLKO_005 1802 3UTR 100% 15.000 7.500 Y Cmtr1 n/a
2 TRCN0000264858 GCTTTGGGTACTGGGTATAAT pLKO_005 6035 3UTR 100% 15.000 7.500 Y Cmtr1 n/a
3 TRCN0000264859 CATCAATGCATTTCGGAATTT pLKO_005 2461 3UTR 100% 13.200 6.600 Y Cmtr1 n/a
4 TRCN0000200675 GACTACATGATACGCTCTAAT pLKO.1 2918 3UTR 100% 13.200 6.600 Y Cmtr1 n/a
5 TRCN0000264862 GACTACATGATACGCTCTAAT pLKO_005 2918 3UTR 100% 13.200 6.600 Y Cmtr1 n/a
6 TRCN0000039432 GCTCTAATGGAAGAACTAAAT pLKO.1 1233 3UTR 100% 13.200 6.600 Y Rnf8 n/a
7 TRCN0000264861 TACATTGTCAGGACCGTAAAT pLKO_005 5272 3UTR 100% 13.200 6.600 Y Cmtr1 n/a
8 TRCN0000191183 CCAGAGAACATCAATGCATTT pLKO.1 2453 3UTR 100% 10.800 5.400 Y Cmtr1 n/a
9 TRCN0000192474 CCTGATGAATGTCCTGTCATT pLKO.1 5553 3UTR 100% 4.950 2.475 Y Cmtr1 n/a
10 TRCN0000039431 ACAGGGTTATTGCATCCGTAA pLKO.1 464 3UTR 100% 4.050 2.025 Y Rnf8 n/a
11 TRCN0000039429 CGGAAAGTAGAGTGTCCCATT pLKO.1 1485 3UTR 100% 4.050 2.025 Y Rnf8 n/a
12 TRCN0000039433 CTGGCTAATGTCGCCAGTAAA pLKO.1 705 3UTR 100% 1.320 0.660 Y Rnf8 n/a
13 TRCN0000039430 GCTCGAGAACTAAGAGGAAAT pLKO.1 625 3UTR 100% 0.000 0.000 Y Rnf8 n/a
14 TRCN0000143867 GCATAGATGATGTTCGGGATT pLKO.1 2793 3UTR 100% 4.050 2.025 Y CMTR1 n/a
15 TRCN0000278424 GCATAGATGATGTTCGGGATT pLKO_005 2793 3UTR 100% 4.050 2.025 Y CMTR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.