Transcript: Mouse NR_132588.1

Mus musculus SH2 domain containing 1A (Sh2d1a), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Sh2d1a (20400)
Length:
824
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132588.1
NBCI Gene record:
Sh2d1a (20400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_132588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081158 GCACGACTCTAGTCCTGTAAT pLKO.1 579 3UTR 100% 13.200 18.480 N Sh2d1a n/a
2 TRCN0000081162 ACAGGGAGAAGAGATTCTGAT pLKO.1 434 3UTR 100% 4.950 3.465 N Sh2d1a n/a
3 TRCN0000081160 CCTCTGCAGTATCCAGTTGAA pLKO.1 383 3UTR 100% 4.950 3.465 N Sh2d1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.