Transcript: Mouse NR_132589.1

Mus musculus translocase of inner mitochondrial membrane 17b (Timm17b), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Timm17b (21855)
Length:
1603
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132589.1
NBCI Gene record:
Timm17b (21855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_132589.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348207 AGCTTCATACGTGTAACAATT pLKO_005 735 3UTR 100% 13.200 18.480 N Timm17b n/a
2 TRCN0000114229 CCGGTTCAGAGGTAGTGTCAA pLKO.1 146 3UTR 100% 4.950 3.960 N Timm17b n/a
3 TRCN0000334078 CCGGTTCAGAGGTAGTGTCAA pLKO_005 146 3UTR 100% 4.950 3.960 N Timm17b n/a
4 TRCN0000348136 GCATCCTTCTCACCCGCTATA pLKO_005 397 3UTR 100% 10.800 7.560 N Timm17b n/a
5 TRCN0000114228 CCGCTATACTGCCCAGCAGTT pLKO.1 410 3UTR 100% 1.350 0.945 N Timm17b n/a
6 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1001 3UTR 100% 4.950 2.475 Y ERN2 n/a
7 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1001 3UTR 100% 4.950 2.475 Y P3H4 n/a
8 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1001 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1003 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1003 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132589.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.