Transcript: Human NR_134952.2

Homo sapiens integrin subunit beta 1 binding protein 1 (ITGB1BP1), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ITGB1BP1 (9270)
Length:
4204
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134952.2
NBCI Gene record:
ITGB1BP1 (9270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122920 GCAGTTCCCAAAGTAGCGAAA pLKO.1 226 3UTR 100% 4.050 5.670 N ITGB1BP1 n/a
2 TRCN0000319015 GCAGTTCCCAAAGTAGCGAAA pLKO_005 226 3UTR 100% 4.050 5.670 N ITGB1BP1 n/a
3 TRCN0000122919 CCAACCACAATTCCTAGAGTT pLKO.1 1845 3UTR 100% 4.950 3.960 N ITGB1BP1 n/a
4 TRCN0000122921 CCTGTGCAGAATTTCGAATAA pLKO.1 367 3UTR 100% 13.200 9.240 N ITGB1BP1 n/a
5 TRCN0000319016 CCTGTGCAGAATTTCGAATAA pLKO_005 367 3UTR 100% 13.200 9.240 N ITGB1BP1 n/a
6 TRCN0000122922 GCAAGATGGAAAGTTGCCTTT pLKO.1 680 3UTR 100% 4.050 2.835 N ITGB1BP1 n/a
7 TRCN0000319089 GCAAGATGGAAAGTTGCCTTT pLKO_005 680 3UTR 100% 4.050 2.835 N ITGB1BP1 n/a
8 TRCN0000122923 TGAAGGGCCATTAGACCTGAT pLKO.1 437 3UTR 100% 4.050 2.835 N ITGB1BP1 n/a
9 TRCN0000319088 TGAAGGGCCATTAGACCTGAT pLKO_005 437 3UTR 100% 4.050 2.835 N ITGB1BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.