Transcript: Human NR_135593.2

Homo sapiens histone deacetylase 6 (HDAC6), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
HDAC6 (10013)
Length:
1839
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135593.2
NBCI Gene record:
HDAC6 (10013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380796 CCCAATCTAGCGGAGGTAAAG pLKO_005 246 3UTR 100% 10.800 15.120 N HDAC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11445 pDONR223 100% 20.3% None (many diffs) n/a
2 ccsbBroad304_11445 pLX_304 0% 20.3% V5 (many diffs) n/a
3 TRCN0000473847 ACACTGCCCGTATTCTGTATTAAG pLX_317 77.9% 20.3% V5 (many diffs) n/a
Download CSV