Transcript: Human NR_135780.1

Homo sapiens arginine and serine rich protein 1 (RSRP1), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
RSRP1 (57035)
Length:
2471
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135780.1
NBCI Gene record:
RSRP1 (57035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159975 CGAATGGAGCTGTTAGAAATA pLKO.1 800 3UTR 100% 13.200 18.480 N RSRP1 n/a
2 TRCN0000158859 GATGGCTAAGTTTGCATGAAA pLKO.1 2132 3UTR 100% 5.625 7.875 N RSRP1 n/a
3 TRCN0000137261 GCCGTGGAATAGGTGTATCAA pLKO.1 909 3UTR 100% 5.625 7.875 N RSRP1 n/a
4 TRCN0000162817 CAAGCCGTGGAATAGGTGTAT pLKO.1 906 3UTR 100% 4.950 6.930 N RSRP1 n/a
5 TRCN0000133727 GATATGAGAGATAGCACAGAT pLKO.1 2294 3UTR 100% 4.950 6.930 N RSRP1 n/a
6 TRCN0000161398 GCTCTAGGAACAACCAACATT pLKO.1 842 3UTR 100% 5.625 4.500 N RSRP1 n/a
7 TRCN0000162624 CCAGCAAAGAAGCATAGCTTT pLKO.1 1972 3UTR 100% 4.950 3.465 N RSRP1 n/a
8 TRCN0000137055 CCAGCTAGTCTCAGAACTGTT pLKO.1 869 3UTR 100% 4.950 3.465 N RSRP1 n/a
9 TRCN0000159974 CTCTTGCAGATATGAGAGATA pLKO.1 2286 3UTR 100% 4.950 3.465 N RSRP1 n/a
10 TRCN0000163784 GCACAGATGGACCAAAGGTTA pLKO.1 2307 3UTR 100% 4.950 3.465 N RSRP1 n/a
11 TRCN0000160766 CTAGCATTATCCCATCCCTTT pLKO.1 2180 3UTR 100% 4.050 2.835 N RSRP1 n/a
12 TRCN0000159093 GCTCTAATAATTCTGTAGCAA pLKO.1 1995 3UTR 100% 3.000 2.100 N RSRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08688 pDONR223 100% 35.1% None (many diffs) n/a
Download CSV