Transcript: Human NR_136216.2

Homo sapiens contactin associated protein like 4 (CNTNAP4), transcript variant 14, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CNTNAP4 (85445)
Length:
6492
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136216.2
NBCI Gene record:
CNTNAP4 (85445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119236 CCTGGAACCATTTCTTCTATA pLKO.1 2293 3UTR 100% 13.200 9.240 N CNTNAP4 n/a
2 TRCN0000119235 CGAGGCTTCATATCTTCATTT pLKO.1 2888 3UTR 100% 13.200 9.240 N CNTNAP4 n/a
3 TRCN0000119234 CCAGTAACTAAGATCGTGATT pLKO.1 2769 3UTR 100% 4.950 3.465 N CNTNAP4 n/a
4 TRCN0000119233 GCCTTCTATCAAAGCCAGATT pLKO.1 703 3UTR 100% 4.950 3.465 N CNTNAP4 n/a
5 TRCN0000119232 CATAGCATTCATTCTATGGAA pLKO.1 4595 3UTR 100% 0.300 0.210 N CNTNAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.