Transcript: Human NR_136732.1

Homo sapiens RNA binding motif protein 41 (RBM41), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
RBM41 (55285)
Length:
6699
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136732.1
NBCI Gene record:
RBM41 (55285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137155 GCTGAGTATGAAGGGTAAAGT pLKO.1 1261 3UTR 100% 5.625 7.875 N RBM41 n/a
2 TRCN0000134374 GACAGATGATATGCTGAGTAT pLKO.1 1249 3UTR 100% 4.950 6.930 N RBM41 n/a
3 TRCN0000137894 GCTACAGGTAGCACTACAGAA pLKO.1 1022 3UTR 100% 4.950 6.930 N RBM41 n/a
4 TRCN0000133976 CAACGGATTATTCCTAAGGAT pLKO.1 1313 3UTR 100% 3.000 4.200 N RBM41 n/a
5 TRCN0000414195 AGAGCCCATTTGCCATATTTC pLKO_005 1459 3UTR 100% 13.200 9.240 N RBM41 n/a
6 TRCN0000414150 GCAAGCATTGCATCTAGTAAA pLKO_005 907 3UTR 100% 13.200 9.240 N RBM41 n/a
7 TRCN0000135042 CCATTGAGGAATGTATGTCTA pLKO.1 263 3UTR 100% 4.950 3.465 N RBM41 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4429 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4351 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4352 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.