Transcript: Mouse NR_136920.1

Mus musculus predicted gene 4425 (Gm4425), non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Gm4425 (100043416)
Length:
2857
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136920.1
NBCI Gene record:
Gm4425 (100043416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_136920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096024 GCGTGCATATTCCCAACCTAA pLKO.1 1664 3UTR 100% 4.950 3.960 N n/a
2 TRCN0000243552 ACTGGAACCTCACTGTTATAG pLKO_005 522 3UTR 100% 13.200 6.600 Y Gm9222 n/a
3 TRCN0000239455 CTCAGAAGAGTCTCTACAAAG pLKO_005 483 3UTR 100% 10.800 5.400 Y Gm14288 n/a
4 TRCN0000096027 GAGTCTCTACAAAGATATGAT pLKO.1 490 3UTR 100% 5.625 2.813 Y n/a
5 TRCN0000095841 CCTACTGGAACCTCACTGTTA pLKO.1 519 3UTR 100% 4.950 2.475 Y 2410018L13Rik n/a
6 TRCN0000096026 CTTCTCTTCCAGGTTTCCAAA pLKO.1 609 3UTR 100% 4.950 2.475 Y n/a
7 TRCN0000095842 GACATTGTCAAAGTTCAAGAA pLKO.1 573 3UTR 100% 4.950 2.475 Y 2410018L13Rik n/a
8 TRCN0000096028 TCACTGTTATAGGCTACACTT pLKO.1 531 3UTR 100% 4.950 2.475 Y n/a
9 TRCN0000096025 GTGACTTATGATGATGTGCAT pLKO.1 422 3UTR 100% 2.640 1.320 Y n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2833 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.