Transcript: Human NR_138104.1

Homo sapiens zinc finger protein 875 (ZNF875), transcript variant 22, non-coding RNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
ZNF875 (284459)
Length:
2892
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138104.1
NBCI Gene record:
ZNF875 (284459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232378 CAGAATGTGGGCGTCACTTTA pLKO_005 1563 3UTR 100% 13.200 18.480 N ZNF875 n/a
2 TRCN0000017634 GCCTAACCTGTTTAGGCACAA pLKO.1 1927 3UTR 100% 0.405 0.567 N ZNF875 n/a
3 TRCN0000017636 CCAGAATCGAAGCCAGAAATT pLKO.1 542 3UTR 100% 13.200 17.160 N ZNF875 n/a
4 TRCN0000232379 GCTAAGTTAACTCTCATTAAA pLKO_005 2000 3UTR 100% 15.000 10.500 N ZNF875 n/a
5 TRCN0000232380 ACAAATCAGTCAACGTGTATT pLKO_005 2716 3UTR 100% 13.200 9.240 N ZNF875 n/a
6 TRCN0000232377 ACAACACAGTGGTGGATATAG pLKO_005 864 3UTR 100% 13.200 9.240 N ZNF875 n/a
7 TRCN0000257258 TAGTCGGAAGTCCAACCTTAT pLKO_005 2164 3UTR 100% 10.800 7.560 N ZNF875 n/a
8 TRCN0000017637 GACTCCTGTTTGGGAGAGTAA pLKO.1 774 3UTR 100% 4.950 3.465 N ZNF875 n/a
9 TRCN0000017633 CCATTCTGCTTTAGTGGCAAA pLKO.1 722 3UTR 100% 4.050 2.835 N ZNF875 n/a
10 TRCN0000017635 CTGAAGTCAAACCTTAACAAA pLKO.1 1670 3UTR 100% 5.625 3.375 N ZNF875 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15299 pDONR223 51.8% 64.9% None (many diffs) n/a
2 ccsbBroad304_15299 pLX_304 0% 64.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV