Transcript: Human NR_145417.1

Homo sapiens zinc ribbon domain containing 1 antisense, pseudogene (ZNRD1ASP), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
ZNRD1ASP (80862)
Length:
3558
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145417.1
NBCI Gene record:
ZNRD1ASP (80862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377812 CCAAACCTGCATCCATCATTT pLKO_005 3169 3UTR 100% 13.200 6.600 Y CSN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12711 pDONR223 100% 15.7% None 1_630del;1192_3558del n/a
2 ccsbBroad304_12711 pLX_304 0% 15.7% V5 1_630del;1192_3558del n/a
3 TRCN0000472159 TGACTTCGCCTATGTAAATGCCCG pLX_317 88.1% 15.7% V5 1_630del;1192_3558del n/a
Download CSV