Transcript: Human NR_146206.2

Homo sapiens progesterone immunomodulatory binding factor 1 (PIBF1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PIBF1 (10464)
Length:
3018
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146206.2
NBCI Gene record:
PIBF1 (10464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168039 CGCTTCTATGAGCTAGTGAAT pLKO.1 820 3UTR 100% 4.950 6.930 N PIBF1 n/a
2 TRCN0000244187 AGCACCTGTAGACCATTATAT pLKO_005 2491 3UTR 100% 15.000 10.500 N PIBF1 n/a
3 TRCN0000244188 ACTATGATGATCGACAATTTG pLKO_005 475 3UTR 100% 13.200 9.240 N PIBF1 n/a
4 TRCN0000244190 ATGAGCTAGTGAATCCATTAA pLKO_005 827 3UTR 100% 13.200 9.240 N PIBF1 n/a
5 TRCN0000244186 CTCGTTAAGATGCATAGTAAA pLKO_005 2276 3UTR 100% 13.200 9.240 N PIBF1 n/a
6 TRCN0000167125 CCTCTCACATGATTCAAACAA pLKO.1 1133 3UTR 100% 5.625 3.938 N PIBF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11505 pDONR223 100% 68.1% None (many diffs) n/a
2 ccsbBroad304_11505 pLX_304 0% 68.1% V5 (many diffs) n/a
Download CSV