Transcript: Human NR_146787.2

Homo sapiens HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 (HACE1), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
HACE1 (57531)
Length:
4403
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146787.2
NBCI Gene record:
HACE1 (57531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427070 CTTAGCCTCTCTAGCAATTAT pLKO_005 1037 3UTR 100% 15.000 21.000 N HACE1 n/a
2 TRCN0000003413 GCTGTGCCATATACTCCAAAT pLKO.1 2689 3UTR 100% 10.800 15.120 N HACE1 n/a
3 TRCN0000003414 CGGAAGGATTTGTTATGTTTA pLKO.1 3858 3UTR 100% 13.200 10.560 N HACE1 n/a
4 TRCN0000003415 GCAGATTGTCAGGATGTTATT pLKO.1 1433 3UTR 100% 13.200 9.240 N HACE1 n/a
5 TRCN0000415313 TGCTACAACAAATGGTCATAA pLKO_005 1012 3UTR 100% 13.200 9.240 N HACE1 n/a
6 TRCN0000003417 GCCAGTACCTAAAGATTCTAA pLKO.1 975 3UTR 100% 5.625 3.938 N HACE1 n/a
7 TRCN0000003416 CCAGAAATTGATGTGAGTGAT pLKO.1 2470 3UTR 100% 4.950 3.465 N HACE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.