Transcript: Human NR_148000.2

Homo sapiens zinc finger protein 248 (ZNF248), transcript variant 40, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZNF248 (57209)
Length:
4065
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148000.2
NBCI Gene record:
ZNF248 (57209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017466 GTGATCTTTAAGATCGAGCAA pLKO.1 717 3UTR 100% 2.640 3.696 N ZNF248 n/a
2 TRCN0000232291 CTAAACCAGAAGTGATCTTTA pLKO_005 706 3UTR 100% 13.200 7.920 N ZNF248 n/a
3 TRCN0000146346 CCTCAGAATGTGACTGTATTT pLKO.1 3793 3UTR 100% 13.200 6.600 Y VNN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15944 pDONR223 0% 8.1% None (many diffs) n/a
Download CSV