Transcript: Human NR_148034.2

Homo sapiens calcium responsive transcription factor (CARF), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CARF (79800)
Length:
6542
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148034.2
NBCI Gene record:
CARF (79800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265727 GAGACCATTTGTGGGTATATT pLKO_005 3416 3UTR 100% 15.000 21.000 N CARF n/a
2 TRCN0000256029 GTGTTGCACTATAGGTAATAT pLKO_005 3937 3UTR 100% 15.000 21.000 N CARF n/a
3 TRCN0000256023 TATATGGGCCTGCCGTCTTAG pLKO_005 621 3UTR 100% 10.800 15.120 N CARF n/a
4 TRCN0000156177 CCCTCACGTTTACATCCTCAA pLKO.1 1128 3UTR 100% 4.050 5.670 N CARF n/a
5 TRCN0000150380 CCAAGTTAAACAAGAACCCAA pLKO.1 1819 3UTR 100% 2.640 3.696 N CARF n/a
6 TRCN0000151354 GTCTTAGAAAGGAAGGTGAAT pLKO.1 1948 3UTR 100% 4.950 3.960 N CARF n/a
7 TRCN0000256025 ACCAGCTGTGGTATCAGTAAA pLKO_005 1456 3UTR 100% 13.200 9.240 N CARF n/a
8 TRCN0000256027 CACTCATATCACAGAATATAC pLKO_005 430 3UTR 100% 13.200 9.240 N CARF n/a
9 TRCN0000150753 GAGACCATGACAGTTACATTT pLKO.1 1256 3UTR 100% 13.200 9.240 N CARF n/a
10 TRCN0000256024 TTAGAAAGTGTCCTAACATTT pLKO_005 697 3UTR 100% 13.200 9.240 N CARF n/a
11 TRCN0000153667 CATCACTACTCGTGAAGCAAA pLKO.1 404 3UTR 100% 4.950 3.465 N CARF n/a
12 TRCN0000151436 GCAGACTATTCCAATACAGAT pLKO.1 1741 3UTR 100% 4.950 3.465 N CARF n/a
13 TRCN0000150930 GCAGGCTATTCAATATGAACT pLKO.1 515 3UTR 100% 4.950 3.465 N CARF n/a
14 TRCN0000143425 CCTCTTTGTGATCCCTTCTTA pLKO.1 6233 3UTR 100% 5.625 3.375 N NBEAL1 n/a
15 TRCN0000143330 GCTGGCTTAGACATCAAACAT pLKO.1 5736 3UTR 100% 5.625 3.375 N NBEAL1 n/a
16 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3239 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.