Transcript: Human NR_148535.2

Homo sapiens ER membrane protein complex subunit 3 (EMC3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
EMC3 (55831)
Length:
1552
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148535.2
NBCI Gene record:
EMC3 (55831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424793 TTGCAAGAACCGGTCACTTAT pLKO_005 966 3UTR 100% 13.200 18.480 N LOC401052 n/a
2 TRCN0000162208 CGATCTACTTGCTACTTCTAT pLKO.1 1356 3UTR 100% 5.625 7.875 N LOC401052 n/a
3 TRCN0000164604 CCATCGATCTACTTGCTACTT pLKO.1 1352 3UTR 100% 4.950 6.930 N LOC401052 n/a
4 TRCN0000439389 AGCGCTTCATGCCACTGTTAT pLKO_005 437 3UTR 100% 13.200 9.240 N LOC401052 n/a
5 TRCN0000163836 CCTGAGACTTTGGTCCTTTAA pLKO.1 1279 3UTR 100% 13.200 9.240 N LOC401052 n/a
6 TRCN0000165773 CCCTGAGACTTTGGTCCTTTA pLKO.1 1278 3UTR 100% 10.800 7.560 N LOC401052 n/a
7 TRCN0000163165 GCTTCATGCCACTGTTATCAA pLKO.1 440 3UTR 100% 5.625 3.938 N LOC401052 n/a
8 TRCN0000435614 GGACCTCTCAGCATGATTGAC pLKO_005 610 3UTR 100% 4.950 3.465 N LOC401052 n/a
9 TRCN0000164733 CATCGAAGCAGAAAGGCCAAT pLKO.1 471 3UTR 100% 4.050 2.835 N LOC401052 n/a
10 TRCN0000163138 GAAGAAACCATCGAAGCAGAA pLKO.1 463 3UTR 100% 4.050 2.835 N LOC401052 n/a
11 TRCN0000166343 CAAAGGGAGATGAACAAGCCA pLKO.1 297 3UTR 100% 0.750 0.525 N LOC401052 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.