Transcript: Human NR_149162.2

Homo sapiens telomerase reverse transcriptase (TERT), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TERT (7015)
Length:
3687
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149162.2
NBCI Gene record:
TERT (7015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_149162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240464 ACATGCGTCGCAAACTCTTTG pLKO_005 2614 3UTR 100% 10.800 15.120 N TERT n/a
2 TRCN0000240466 GACGGTGTGCACCAACATCTA pLKO_005 2693 3UTR 100% 4.950 6.930 N TERT n/a
3 TRCN0000219794 CCTGCGTTTGGTGGATGATTT pLKO.1 2486 3UTR 100% 13.200 9.240 N TERT n/a
4 TRCN0000240463 TCTGCTACTCCATCCTGAAAG pLKO_005 2833 3UTR 100% 10.800 7.560 N TERT n/a
5 TRCN0000219795 TGAGGCCTGAGTGAGTGTTTG pLKO.1 3222 3UTR 100% 10.800 7.560 N TERT n/a
6 TRCN0000240465 ATGTCACGGAGACCACGTTTC pLKO_005 1764 3UTR 100% 6.000 4.200 N TERT n/a
7 TRCN0000179552 GACATGGAGAACAAGCTGTTT pLKO.1 2439 3UTR 100% 4.950 3.465 N TERT n/a
8 TRCN0000240467 CCCACATAGGAATAGTCCATC pLKO_005 3412 3UTR 100% 4.050 2.835 N TERT n/a
9 TRCN0000180472 GCATTGGAATCAGACAGCACT pLKO.1 1836 3UTR 100% 2.640 1.848 N TERT n/a
10 TRCN0000180780 GAAGAGTGTCTGGAGCAAGTT pLKO.1 1810 3UTR 100% 4.950 2.970 N TERT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.