Transcript: Human NR_152608.1

Homo sapiens MAPKAPK5 antisense RNA 1 (MAPKAPK5-AS1), transcript variant 5, long non-coding RNA.

Source:
NCBI, updated 2019-01-26
Taxon:
Homo sapiens (human)
Gene:
MAPKAPK5-AS1 (51275)
Length:
958
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_152608.1
NBCI Gene record:
MAPKAPK5-AS1 (51275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_152608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163149 GCATTAACCTTACGTGGAGTT pLKO.1 173 3UTR 100% 4.050 5.670 N MAPKAPK5-AS1 n/a
2 TRCN0000166460 CGTCTTTACAAGGTAGCCGTT pLKO.1 215 3UTR 100% 2.160 3.024 N MAPKAPK5-AS1 n/a
3 TRCN0000161267 GTGGAGTTATTTCCTGCATTT pLKO.1 186 3UTR 100% 10.800 7.560 N MAPKAPK5-AS1 n/a
4 TRCN0000163395 GATGCCATTGAGTGAGTGAAA pLKO.1 497 3UTR 100% 4.950 3.465 N MAPKAPK5-AS1 n/a
5 TRCN0000164378 CCTGAAGGATTAGATGTGGAA pLKO.1 411 3UTR 100% 2.640 1.848 N MAPKAPK5-AS1 n/a
6 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 317 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_152608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.