Transcript: Human NR_154586.1

Homo sapiens zinc finger containing ubiquitin peptidase 1 (ZUP1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
ZUP1 (221302)
Length:
2114
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_154586.1
NBCI Gene record:
ZUP1 (221302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_154586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229397 GAAGCACTTCATAGGTATTAT pLKO_005 1230 3UTR 100% 15.000 21.000 N ZUP1 n/a
2 TRCN0000129105 CCCTCGCTTATTTGAATGGAT pLKO.1 1528 3UTR 100% 3.000 4.200 N ZUP1 n/a
3 TRCN0000229398 GGTACACACCCTCGCTTATTT pLKO_005 1520 3UTR 100% 15.000 12.000 N ZUP1 n/a
4 TRCN0000241318 GGTACACACCCTCGCTTATTT pLKO_005 1520 3UTR 100% 15.000 12.000 N Zufsp n/a
5 TRCN0000146653 CAAGTTGTCAGGTGTGAATTA pLKO.1 362 3UTR 100% 13.200 10.560 N ZUP1 n/a
6 TRCN0000129655 CCTAAGGGTAAAGTGTCATAT pLKO.1 1468 3UTR 100% 13.200 10.560 N ZUP1 n/a
7 TRCN0000229396 AGTCCAGCCTGACCGAAATAA pLKO_005 667 3UTR 100% 15.000 10.500 N ZUP1 n/a
8 TRCN0000218130 CAACAACAACTACGAAATATG pLKO_005 1089 3UTR 100% 13.200 9.240 N ZUP1 n/a
9 TRCN0000147954 GACAAGCTTCTCAAGTCTTTA pLKO.1 1860 3UTR 100% 13.200 9.240 N ZUP1 n/a
10 TRCN0000219806 ATTTAAGCATTTCAGTGATTG pLKO.1 1911 3UTR 100% 10.800 7.560 N ZUP1 n/a
11 TRCN0000219807 GTGATTGAGAACAATACTTTG pLKO.1 1925 3UTR 100% 10.800 7.560 N ZUP1 n/a
12 TRCN0000229399 GTGATTGAGAACAATACTTTG pLKO_005 1925 3UTR 100% 10.800 7.560 N ZUP1 n/a
13 TRCN0000148556 CAGACATGAAAGCTCACCTAA pLKO.1 304 3UTR 100% 4.950 3.465 N ZUP1 n/a
14 TRCN0000130740 GCTTTCAGCAAGGCATGGATA pLKO.1 919 3UTR 100% 4.950 3.465 N ZUP1 n/a
15 TRCN0000128613 CAGTGTGGAATGGAAGTTAAT pLKO.1 504 3UTR 100% 13.200 7.920 N ZUP1 n/a
16 TRCN0000150071 CATGTTGACTTGCATTTGGAA pLKO.1 891 3UTR 100% 3.000 1.800 N ZUP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_154586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05254 pDONR223 100% 74% None 1_260del;1408_1409ins97;1898_2114del n/a
Download CSV