Transcript: Human NR_159381.1

Homo sapiens transmembrane O-mannosyltransferase targeting cadherins 3 (TMTC3), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TMTC3 (160418)
Length:
7316
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159381.1
NBCI Gene record:
TMTC3 (160418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137638 GCTAACCTGATCCGAGCAAAT pLKO.1 1936 3UTR 100% 10.800 7.560 N TMTC3 n/a
2 TRCN0000136904 CCTAAGGATCTGCCATAGATT pLKO.1 4670 3UTR 100% 5.625 3.938 N TMTC3 n/a
3 TRCN0000138331 CGACTTCCGAAGTGCTTTGTT pLKO.1 2430 3UTR 100% 5.625 3.938 N TMTC3 n/a
4 TRCN0000136826 CCAATTGCCTTGACAGTGTTT pLKO.1 726 3UTR 100% 4.950 3.465 N TMTC3 n/a
5 TRCN0000137372 GCATTAGAAGACCCACTCTTA pLKO.1 4641 3UTR 100% 4.950 3.465 N TMTC3 n/a
6 TRCN0000138196 CACAAGTCTTACCGTCCCTTA pLKO.1 408 3UTR 100% 4.050 2.835 N TMTC3 n/a
7 TRCN0000137021 CAGATGATATTGGTGCCCATA pLKO.1 1763 3UTR 100% 4.050 2.835 N TMTC3 n/a
8 TRCN0000133967 CTGGACAGAAATAATGCAGAT pLKO.1 2107 3UTR 100% 4.050 2.835 N TMTC3 n/a
9 TRCN0000138232 CCAGATGATATTGGTGCCCAT pLKO.1 1762 3UTR 100% 2.160 1.512 N TMTC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05107 pDONR223 100% 37.4% None 1_209del;1409_1532del;3076_7316del n/a
2 ccsbBroad304_05107 pLX_304 0% 37.4% V5 1_209del;1409_1532del;3076_7316del n/a
Download CSV