Transcript: Human NR_159504.1

Homo sapiens ring finger protein 212 (RNF212), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
RNF212 (285498)
Length:
2127
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159504.1
NBCI Gene record:
RNF212 (285498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413056 GAGATTGTTAGCCTTCTATAG pLKO_005 314 3UTR 100% 10.800 15.120 N RNF212 n/a
2 TRCN0000073243 CGAATGTTCTATGGGTTTGAA pLKO.1 1237 3UTR 100% 5.625 4.500 N RNF212 n/a
3 TRCN0000073244 CCTGCGAGAATCTCCATGATT pLKO.1 419 3UTR 100% 5.625 3.938 N RNF212 n/a
4 TRCN0000073246 CCAGGCATTCTTCATGAGCAT pLKO.1 224 3UTR 100% 2.640 1.848 N RNF212 n/a
5 TRCN0000428888 GCAGATAGAACAACTACAAAG pLKO_005 380 3UTR 100% 10.800 6.480 N RNF212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05398 pDONR223 100% 26.2% None (many diffs) n/a
2 ccsbBroad304_05398 pLX_304 0% 26.2% V5 (many diffs) n/a
Download CSV